5  displaying pins with different colors on a map view

Báo cáo hóa học: "Dermal absorption of aromatic amines in workers with different skin lesions: a report on 4 cases" doc

Báo cáo hóa học: "Dermal absorption of aromatic amines in workers with different skin lesions: a report on 4 cases" doc

Ngày tải lên : 20/06/2014, 00:20
... TW and JA were responsible for analyses of personal air and biological monitoring TW, JA and HD revised critically the manu- Page of (page number not for citation purposes) Journal of Occupational ... approach of biological monitoring can assess the uptake of hazardous substances by all routes Conclusion Our case report shows that the internal exposure to AA increases in workers with impaired ... biological monitoring of workers can help to monitor the total body burden Declaration of competing interests The author(s) declare that they have no competing interests Abbreviations AA; aromatic amines...
  • 4
  • 426
  • 0
Báo cáo khoa học: "Performance and morphological response of the hybrid poplar DN-74 (Populus deltoides x nigra) under different spacings on a 4-year rotation" pps

Báo cáo khoa học: "Performance and morphological response of the hybrid poplar DN-74 (Populus deltoides x nigra) under different spacings on a 4-year rotation" pps

Ngày tải lên : 08/08/2014, 14:21
... that the increase in SLA with crown depth accentuated with stand density Changes in SLA are often related to sun and shade leaf morphology with anatomical and physiological characteristics adapted ... Klinka K., Kayahara G.J., Effects of light on growth, crown architecture, and specific leaf area for naturally established Pinus contorta var latifolia and Pseudotsuga meuziesii var glauca saplings, ... that the repeated measurement component (γ was excluded ) n Linear regression analysis of SLA as a function of nutrient concentration was undertaken to compare the slope of the relationship...
  • 13
  • 230
  • 0
Báo cáo y học: " Decrease of vitamin D concentration in patients with HIV infection on a non nucleoside reverse transcriptase inhibitor-containing regimen" doc

Báo cáo y học: " Decrease of vitamin D concentration in patients with HIV infection on a non nucleoside reverse transcriptase inhibitor-containing regimen" doc

Ngày tải lên : 10/08/2014, 05:21
... samples available at the start of HAART and 12 months later We compared paired pre-HAART and post-HAART samples The pre-HAART sample was drawn between the start of HAART and maximum months before ... analysis All statistical analyses were performed with STATA and R software Pre-HAART data was summarized using counts and percentages, means and standard deviations for normally distributed data, and ... elevated alanine aminotransferase and aspartate aminotransferase times above the normal reference values All subjects had signed an informed consent allowing additional investigation for research...
  • 6
  • 398
  • 0
Đề tài " A cornucopia of isospectral pairs of metrics on spheres with different local geometries " potx

Đề tài " A cornucopia of isospectral pairs of metrics on spheres with different local geometries " potx

Ngày tải lên : 29/03/2014, 07:20
... (A2 )k are real numbers There is atypical example of an HESWA when A is a diagonal matrix having the same imaginary quaternion (say I) in the main diagonal and the anticommuting matrices are symmetric ... the quaternionic numbers and both can be represented as a diagonal quaternionic matrix such that there are I’s on the diagonal of A and there are J’s on the diagonal of F This lemma easily settles ... such that A2 has the constant eigenvalue a2 on Bc Then all the endomorphisms from ESWA leave c these Jordan subspaces invariant and, in case ac = 0, an F ∈ A can be represented as a matrix...
  • 54
  • 262
  • 0
Báo cáo y học: "Effect of different components of triple-H therapy on cerebral perfusion in patients with aneurysmal subarachnoid haemorrhage: a systematic review" docx

Báo cáo y học: "Effect of different components of triple-H therapy on cerebral perfusion in patients with aneurysmal subarachnoid haemorrhage: a systematic review" docx

Ngày tải lên : 13/08/2014, 20:21
... intracranial complications (cerebral oedema, to 17%) None of the complications were fatal Cerebral perfusion Cerebral perfusion measurement details are summarized in Table Different perfusion measurement ... aneurysmal SAH At least part of the studied population had to be treated with one or more triple-H components and evaluated with a technique measuring CBF Treatment with triple-H components was considered ... aneurysmal subarachnoid hemorrhage: an additional explanation for delayed cerebral ischemia J Cereb Blood Flow Metab 2008, 28:1761-1770 Kozniewska E, Michalik R, Rafalowska J, Gadamski R, Walski...
  • 10
  • 211
  • 0
Báo cáo y học: "The Influence of Hyperbaric Oxygen Treatment on the Healing of Experimental Defects Filled with Different Bone Graft Substitutes"

Báo cáo y học: "The Influence of Hyperbaric Oxygen Treatment on the Healing of Experimental Defects Filled with Different Bone Graft Substitutes"

Ngày tải lên : 25/10/2012, 11:15
... proportional to the osteocalcin concentration 116 Statistical Analysis Graph Pad Prism® V.3 statistical analysis software (Graph Pad Software Inc., San Diego, CA, USA) was used in this study The data ... presented as mean percentage value and standard deviation (FTF; fibrous tissue formation, CMF; cartilage matrix formation, NBF; new bone formation) Variables FTV (mean%±SD% ) CMF (mean%±SD% ) NBF (mean%±SD% ... oxygenation and fracture healing A biochemical study with rats Acta Chir Scand 1972; 138: 39-44 34 Jan AM, Sandor GK, Iera D, Mhawi A, Peel S, Evans AWet al Hyperbaric oxygen results in an increase...
  • 12
  • 698
  • 0
An experimental investigation on hydrogen fuel injection in intake port and manifold with different EGR rates

An experimental investigation on hydrogen fuel injection in intake port and manifold with different EGR rates

Ngày tải lên : 05/09/2013, 15:28
... Alternative fuels, engine calibration, emission optimization Mr N.Saravanan is member of SAE, ISTE E-mail address: sarav_2003@yahoo.co.in, saravanan.n@tatamotors.com G.Nagarajan, M.E, PhD He is having ... uncertainties of other operating parameters are given in Table Appendix shows the mean and standard deviation calculations for samples Table Average uncertainties of some measured and calculated parameters ... Ladommatos N., Abdelhalim S.M., Zhao H and Hu Z, Effects of EGR on heat release in diesel combustion, SAE Transactions 980184:pp 1-15, 1998 [15] N.Saravanan and G.Nagarajan, An insight on hydrogen...
  • 28
  • 367
  • 0
Tài liệu Module 5: Implementing Security on a Web Server ppt

Tài liệu Module 5: Implementing Security on a Web Server ppt

Ngày tải lên : 24/01/2014, 10:20
... authentication is a solution to many of the disadvantages of Basic authentication, and it involves a different way of transmitting authentication credentials When you use Digest authentication, ... files and Web Distributed Authoring and Versioning (WebDAV) access Configuring Authentication for a Web Server Explain each of the authentication methods with an emphasis on Anonymous, Basic, and ... Security on a Web Server 17 Using Anonymous Authentication Topic Objective To explain Anonymous authentication and how it works No User Name or Password Required Lead-in Anonymous authentication allows...
  • 80
  • 280
  • 0
Đề tài " On a class of type II1 factors with Betti numbers invariants " pdf

Đề tài " On a class of type II1 factors with Betti numbers invariants " pdf

Ngày tải lên : 06/03/2014, 08:21
... factors M having HT Cartan subalgebras A ⊂ M , i.e., maximal abelian ∗ -subalgebras A ⊂ M such that M has the property H relative to A and A contains a subalgebra A0 ⊂ A with A0 ∩ M = A and A0 ... always a 2-cocycle, ∀R), there exists a type II1 factor with a Cartan subalgebra (A ⊂ M ) associated with it, via a groupmeasure space construction “` la” Murray-von Neumann The association a (A ... N has the property H relative to B If N is an arbitrary finite von Neumann algebra with a normal faithful tracial state τ and B ⊂ N is a von Neumann subalgebra, then the amenability of N relative...
  • 92
  • 436
  • 0
Báo cáo khoa học: Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon 9 deletion on c- and e-cleavage doc

Báo cáo khoa học: Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon 9 deletion on c- and e-cleavage doc

Ngày tải lên : 08/03/2014, 08:20
... Muscat, University of Queensland, St Lucia, Australia) with primer 3a (5¢-GGTGATGCTG AAGAAGAAACAGTACATGAAGCTACTGTCTTC TATCG-3¢) and primer (5¢-GCTCTAGAGCTTCAC GGATGCATTATCGATGGGCTC-3¢) Both DNA ... (Roche) and primers 11 (5¢-CTAGCTAGCATGACAGA GTTACCTGCACC-3¢) and 12 (5¢-ATAGTTTAGCG GCCGCTAGATATAAAATTGATGGAATGC-3¢) were used to amplify presenilin DNA DNA sequencing revealed that some clones contained ... H Clarris, University of Melbourne, Parkville, Australia) with primer (5¢-TCAGGAGCTAA GGAAGCTAAAATGGTGAGCAAGGGCGAG-3¢) and primer (5¢-CCGCTCGAGTTACTTGTACAGCTCGT CCATGCC-3¢) The splice-overlap...
  • 12
  • 471
  • 0
Đề tài " On the periods of motives with complex multiplication and a conjecture of GrossDeligne " pdf

Đề tài " On the periods of motives with complex multiplication and a conjecture of GrossDeligne " pdf

Ngày tải lên : 14/03/2014, 22:20
... Recall that a period of an algebraic variety defined by polynomial equations with algebraic coefficients is the integral of an algebraic differential against a rational homology cycle In his article ... has a cycle class in the dual of a rational homology space of X and the duals of these cycle classes span a subspace of homology, which might be large Up to normalisation, the integral of an algebraic ... 730 VINCENT MAILLOT AND DAMIAN ROESSLER Recall that an Artin character of Q is a character of a finite dimensional complex representation of the automorphism group of the normalisation Q of Q over...
  • 29
  • 512
  • 0
A REVIEW OF MILK PRODUCTION IN INDIA WITH PARTICULAR EMPHASIS ON SMALL-SCALE PRODUCERS pdf

A REVIEW OF MILK PRODUCTION IN INDIA WITH PARTICULAR EMPHASIS ON SMALL-SCALE PRODUCERS pdf

Ngày tải lên : 24/03/2014, 04:20
... Haryana 3.2 Natural Conditions and Farm Structure in Haryana Natural Conditions Temperature Haryana experiences moderate and high temperatures throughout the year with only slight variation between ... seasons Rainfall Summer is the rainy season in Haryana However, the state has a good irrigation system, which makes farmers relatively independent of rainfall State Farmland Structure Haryana ... (b) farm size and (c) the production systems that make important contributions to milk production in Haryana state Data was collected using a standard questionnaire and a computer simulation model,...
  • 61
  • 425
  • 0
The effect of Qigong on general and psychosocial health of elderly with chronic physical illnesses: a randomized clinical trial doc

The effect of Qigong on general and psychosocial health of elderly with chronic physical illnesses: a randomized clinical trial doc

Ngày tải lên : 28/03/2014, 19:21
... rehabilitation professionals in Hong Kong Local validation studies showed that is it reliable and valid (Chiu et al., 1993; Wong et al., 2002) Perceived Benefit Questionnaire A 21-item questionnaire ... status Single Married—deceased Married—alive Diagnosis COPD CVA RA Parkinson Others Live with whom Family Spouse Alone Life roles Retired Financial source Family Savings NDA/HDA CSSA Allowances ... antidepressants (Yu, 1999) This may be because Qigong practice has an emphasis on breathing relaxation When the body and mind are calm, a person’s physical and mental functions are better Correct posturing,...
  • 9
  • 555
  • 0
Báo cáo hóa học: "Regulatory T cell frequency in patients with melanoma with different disease stage and course, and modulating effects of high-dose interferon-a 2b treatment" pptx

Báo cáo hóa học: "Regulatory T cell frequency in patients with melanoma with different disease stage and course, and modulating effects of high-dose interferon-a 2b treatment" pptx

Ngày tải lên : 18/06/2014, 16:20
... Suciu S, on behalf of International Malignant Melanoma Collaborative G: Interferon -a as adjuvant therapy for melanoma: an individual patient data meta-analysis of randomised trials J Clin Oncol ... Health “Ricerca Oncologica - Programma Integrato Oncologia” and Associazione UMANA Onlus The author wishes to thank Ilenia Visconti for data management Editorial support for this manuscript was ... function (serum bilirubin < 1.5 × ULN and aspartate transaminase/alanine transaminase ≤ 2.5 × ULN); and adequate cardiac function Exclusion criteria were: brain metastases (including excised) and...
  • 13
  • 642
  • 0
báo cáo hóa học: " Impact of a child with congenital anomalies on parents (ICCAP) questionnaire; a psychometric analysis" pptx

báo cáo hóa học: " Impact of a child with congenital anomalies on parents (ICCAP) questionnaire; a psychometric analysis" pptx

Ngày tải lên : 18/06/2014, 19:20
... Abdominal wall defect Congenital diaphragmatic hernia Small intestinal anomaly Oesophageal atresia Anorectal malformation Hirschsprung's disease Miscellaneous Congenital anomalies (CA) per patient ... that signal high risk for early stress Tailored interventions to ease the parental adaptation process can thus be evaluated Abbreviations CA: Congenital Anomaly; MCA: Multiple Congenital Anomalies; ... measurement moments with a slight decrease in magnitude at months High parental age and longer duration of parental relationship were risk factors for parental relationship and child acceptance, respectively,...
  • 10
  • 508
  • 0
báo cáo hóa học: " Effect of dexamethasone on quality of life in children with acute lymphoblastic leukaemia: a prospective observational study" pdf

báo cáo hóa học: " Effect of dexamethasone on quality of life in children with acute lymphoblastic leukaemia: a prospective observational study" pdf

Ngày tải lên : 18/06/2014, 19:20
... demonstrated For both periods on and off dexamethasone, there was a significant positive correlation between parent and child answers (on dexamethasone r = 0.76 [p < 0.001] and off dexamethasone ... Physical Functioning Role Limitations: emotional/ behaviour Role Limitations: physical Bodily Pain General Behaviour Mental Health Self-esteem General Health Perception Parental Impact: emotional ... Srivastava DK, Tong X, Jones H, West N, McCarthy KS, Sadeh A, Ash M, Fernandez C, Pui CH: Dexamethasone alters sleep and fatigue in pediatric patients with acute lymphoblastic leukemia Cancer...
  • 8
  • 474
  • 0
báo cáo hóa học:" Effects of TGF-β1 and IGF-1 on proliferation of human nucleus pulposus cells in medium with different serum concentrations" pptx

báo cáo hóa học:" Effects of TGF-β1 and IGF-1 on proliferation of human nucleus pulposus cells in medium with different serum concentrations" pptx

Ngày tải lên : 20/06/2014, 00:20
... condition was repeated times The plates were incubated at 37°C Assay was carried out at 1-, 3-.5- and 7-day using above mentioned methods Statistical analyses Standard statistical analytical methods ... and revised the manuscript All authors read and approved the final manuscript Acknowledgements The authors thank Xiaohang Zhao and Lijun Zhou from the central laborary of navy general hospital ... increase cell proliferation and stimulate matrix production, especially for individuals in the early stage of degeneration found by MRI examination[16] An[17] reported that the intradiscal administration...
  • 11
  • 605
  • 0
báo cáo hóa học:" Impact of a child with congenital anomalies on parents (ICCAP) questionnaire; a psychometric analysis" pot

báo cáo hóa học:" Impact of a child with congenital anomalies on parents (ICCAP) questionnaire; a psychometric analysis" pot

Ngày tải lên : 20/06/2014, 16:20
... Abdominal wall defect Congenital diaphragmatic hernia Small intestinal anomaly Oesophageal atresia Anorectal malformation Hirschsprung's disease Miscellaneous Congenital anomalies (CA) per patient ... that signal high risk for early stress Tailored interventions to ease the parental adaptation process can thus be evaluated Abbreviations CA: Congenital Anomaly; MCA: Multiple Congenital Anomalies; ... measurement moments with a slight decrease in magnitude at months High parental age and longer duration of parental relationship were risk factors for parental relationship and child acceptance, respectively,...
  • 10
  • 366
  • 0
báo cáo hóa học:" Effect of dexamethasone on quality of life in children with acute lymphoblastic leukaemia: a prospective observational study" pdf

báo cáo hóa học:" Effect of dexamethasone on quality of life in children with acute lymphoblastic leukaemia: a prospective observational study" pdf

Ngày tải lên : 20/06/2014, 16:20
... demonstrated For both periods on and off dexamethasone, there was a significant positive correlation between parent and child answers (on dexamethasone r = 0.76 [p < 0.001] and off dexamethasone ... Physical Functioning Role Limitations: emotional/ behaviour Role Limitations: physical Bodily Pain General Behaviour Mental Health Self-esteem General Health Perception Parental Impact: emotional ... Srivastava DK, Tong X, Jones H, West N, McCarthy KS, Sadeh A, Ash M, Fernandez C, Pui CH: Dexamethasone alters sleep and fatigue in pediatric patients with acute lymphoblastic leukemia Cancer...
  • 8
  • 317
  • 0
Báo cáo hóa học: " Stability of a nonlinear non-autonomous fractional order systems with different delays and non-local conditions" pot

Báo cáo hóa học: " Stability of a nonlinear non-autonomous fractional order systems with different delays and non-local conditions" pot

Ngày tải lên : 20/06/2014, 22:20
... differential-difference equations J Frac Calculus 10, 101–107 (1996) El-Sayed, AMA, Gaafar, FM, Hamadalla, EMA: Stability for a non-local non-autonomous system of fractional order differential equations ... Cite this article as: El-Sayed and Gaafar: Stability of a nonlinear non-autonomous fractional order systems with different delays and non-local conditions Advances in Difference Equations 2011 ... Kilbas, AA, Srivastava, HM, Trujillo, JJ: Theory and Applications of Fractional Differential Equations Elsevier, Amsterdam (2006) Podlubny, I: Fractional Differential Equation Academic Press, San...
  • 8
  • 356
  • 0